Blah blah blah blah blah blah blah blah
ACTCGTATGGAGCGTATGTCAGGCTAAATGCGTGTACTTATGCGTATGGACCTTCTTGCCATGGGAGGCTAGConfused? Copy and paste the above then decode the DNA sequence hereYa ya I was bored...
Not as bored as I was, seeing as I decoded it. LOL. :)
That was funny!!
Ahh, a geek after my own heart *hugs*
Post a Comment
3 comments:
Not as bored as I was, seeing as I decoded it. LOL. :)
That was funny!!
Ahh, a geek after my own heart *hugs*
Post a Comment