Tuesday, July 19, 2005

DNA

ACTCGTATGGAGCGTATGTCAGGCTAAATGCGTGTACTTATGCGTATGGACCTTCTTGCCATGGGAGGCTAG

Confused? Copy and paste the above then decode the DNA sequence here

Ya ya I was bored...

4 comments:

Big Dipper said...

Not as bored as I was, seeing as I decoded it. LOL. :)

Karen said...

TAAGCTGCTGCTGTGGTGGTGTAGGAGGGCATGGATGTCATGCGTATGGACCTTCTTGCC

Bekah said...

That was funny!!

esprit de folie said...

Ahh, a geek after my own heart *hugs*